python - extract each sequencing data as individual file -

-

there ecoli.ffn file rows indicating name of sequencing genes:

$head ecoli.ffn >ecoli16:g027092:gcf_000460315:gi|545267691|ref|nz_ke701669.1|:551259-572036 atgagcctgattattgatgttatttcgcgt aaaacatccgtcaaacaaacgctgattaat >ecoli16:g000011:55989:gi|218693476|ref|nc_011748.1|:1128430-1131042 gtgtacgctatggcgggtaattttgccgat >ecoli16:g000012:55989:gi|218693476|ref|nc_011748.1|:1128430-1131042 gtgtacgctatggcgggtaattttgccgat ctgacagctgttcttacactggattcaacc ctgacagctgttcttacactggattcaacc

as shown above, gene name between 1st , 2nd colon:

g027092 g000011 g000012

i use ecoli.ffn generate 3 files: g027092.txt, g000011.txt,g000012.txt, containing each sequencing data.

for example, g027092.txt contains raw data without header:

$cat g027092.txt atgagcctgattattgatgttatttcgcgt aaaacatccgtcaaacaaacgctgattaat

how make it?

awk rescue!

$ awk -f: -v rs=">" 'nr==fnr{n=split($0,t,"\n");                              for(i=1;i<n;i++) a[t[i]];                              next}                      $2 in a{file=$2".txt";                               sub(/[^\n]+\n/,"");                               print > file}' index file   $ head g*.txt ==> g000011.txt <== gtgtacgctatggcgggtaattttgccgat   ==> g000012.txt <== gtgtacgctatggcgggtaattttgccgat ctgacagctgttcttacactggattcaacc ctgacagctgttcttacactggattcaacc   ==> g027092.txt <== atgagcctgattattgatgttatttcgcgt aaaacatccgtcaaacaaacgctgattaat

explanation

nr==fnr{n=sp... block parses first file , creates lookup table

$2 in a{file=$2".txt"; if current record in lookup table, set file name using key , txt extension

sub(/[^\n]+\n/,"") delete header line

print > file , print specified filename.


Comments

Post a Comment

Popular posts from this blog

ios - Memory not freeing up after popping viewcontroller using ARC -

-
hi project arc based, using uinavigationcontroller make transition between viewcontroller. using profiler analyse happening behind scene memory. noticed when push viewcontroller allocate memory components , when pop not freeing allocated memory. since using arc unable implement dealloc or release component. have analysed in detail , there no memory leak in project. i not using strong property push viewcontroller. here how pushing viewcontroller. viewcontroller *obj = [[viewcontroller alloc] init]; [self.navigationcontroller pushviewcontroller:obj animated:no]; any clue whats going on? should free memory have consumed. please advise your description indicates have retain cycle, leads objects not being deallocated. typical source of retain cycles properties assigned loading nib files (usually declared iboutlet ). two strategies break them , release objects: declare property weak : @property (nonatomic, weak) iboutlet uilabel *statuslabel; set property nil in...
Read more

Django REST Framework perform_create: You cannot call `.save()` after accessing `serializer.data` -

-
i have following viewset: class artistprofileviewset(viewsets.modelviewset): queryset = artistprofile.objects.all() serializer_class = artistprofileserializer def perform_create(self, serializer): if serializer.is_valid(): serializer.save() with following serializers: class simpleartisttrackserializer(serializers.hyperlinkedmodelserializer): class meta: model = artisttrack fields = (...my fields...) class artistprofileserializer(serializers.hyperlinkedmodelserializer): owners = userserializer(many=true, required=false) tracks = simpleartisttrackserializer(many=true, required=false) class meta: model = artistprofile fields = (...my fields...) i getting following error: assertionerror: cannot call `.save()` after accessing `serializer.data`.if need access data before committing database inspect 'serializer.validated_data' instead. i don't see editing serializer.data object. th...
Read more

Why does Go error when trying to marshal this JSON? -

-
i'm trying rather simple example of trying decode json file structs using golang. however, when attempting error that json: cannot unmarshal object go value of type []main.track which don't understand. here's code in question, , json can found here . package main import ( "encoding/json" "fmt" "net/http" "os" ) // tracks group of track types type tracks struct { tracks []track } // track represents singular track type track struct { name string url string artist artist } // artist represents single artist type artist struct { name string mbid string url string } func main() { url := "http://ws.audioscrobbler.com/2.0/?method=geo.gettoptracks&api_key=c1572082105bd40d247836b5c1819623&format=json&country=netherlands" response, err := http.get(url) if err != nil { fmt.printf("%s\n", err) os.exit(1) } de...
Read more